Hepatitis GB Virus C in Patients on Hemodialysis

• Published in: The New England journal of medicine Vol. 334; no. 23; p. 1549
• Main Authors: Dussol, B, de Lamballerie, X, Charrel, R.N
• Format: Journal Article
• Language: English
• Published: United States Massachusetts Medical Society 06-06-1996
• Subjects: Adult; Aged; Base Sequence; Female; Flaviviridae; Hepatitis Viruses - isolation & purification; Hepatitis, Viral, Human - virology; Humans; Male; Middle Aged; Molecular Sequence Data; Polymerase Chain Reaction; Renal Dialysis - adverse effects
• ISSN: 0028-4793; 1533-4406
• DOI: 10.1056/NEJM199606063342319

To the Editor:
A new group of Flaviviridae viruses — hepatitis GB virus C (HGBV-C)
1
and hepatitis G virus (HGV)
2
— has recently been described. Patients infected with these viruses have persistent viremia, and they may have chronic hepatitis.
We tested the serum of 61 patients on hemodialysis for HGBV-C, using a reverse-transcriptase–nested polymerase-chain-reaction (PCR) method with primers located in the
NS3
region of the viral genome. The outer primers
1
were GB-C-a1 and GB-C-sl, and the inner primers were GBCSMAR (sense, 5'ATCCCCTTTTATGGGCATGG) and GBCAMAR (antisense, 5'GARCTGTCYTTiCCCCTRTAATA, in which R denotes A or G and Y denotes C or T). There . . .