Abstract 16138: Serum Microvesicles Containing Archaeal DNA as a New Pathogenetic Factor for Heart Failure in Chagas’ Disease

• Published in: Circulation (New York, N.Y.) Vol. 138; no. Suppl_1 Suppl 1; p. A16138
• Main Authors: Higuchi, Maria de Lourdes, Kawakami, Joyce T, Reis, Marcia M, Oliveira, Luanda, Pereira, Jaqueline J, Ianni, Barbara, Buck, Paula, Bocchi, Edimar A
• Format: Journal Article
• Language: English
• Published: by the American College of Cardiology Foundation and the American Heart Association, Inc 06-11-2018
• ISSN: 0009-7322; 1524-4539

IntroductionAbout 30% of patients with Chagas’ disease (CD) develop heart failure (HF) and myocarditis, without Trypanosoma cruzi (T.cruzi) antigens suggesting action of other factors. Blood microvesicles (MV) are considered protective, but sometimes associated with bad outcome such as in HF. T.cruzi is known to have archaeal genes, suggesting they are carrying symbiotic archaea. In previous work we found increased archaeal AMZ1 collagenase in serum of HF pts.HypothesisTo search if MVs in CD would have different contents, characterizing some as pathogenic.MethodsWe studied sera from CD patients, 26 HF and 21 indetermined form (IF), submitted to manitol/sucrose gradient separation and centrifugation. Supernatant was analyzed for microvesicles by flow cytometer (FC) calibrated with 0.79 to 1.34 μm microspheres, with techniquesin situ hybridization biotinylated archaeal DNA probe, ARCH 915 (GTGCTCCCCCGCCAATTCCT) incubated with PE-Texas Red and anti-AMZ-1 antibody and Alexa Fluor detecting microvesicles containing archaeal collagenase. Samples were analyzed with FlowJo software (Tree Star). Mann-Whitney and Spearman’s correlation tests <0.05 compared HF versus IF groups.ResultsPercentages of AMZ1 positive microvesicles were higher in IF vs HF (P= 0.02), and archaeal DNA MV numbers were higher in HF than IF ( <0.001). There was negative correlation between AMZ1 positive MVs vs archaeal DNA MVs (r= -0.5; < 0.01) in HF, without correlation in IF (r=-0.004; P=0.98).ConclusionsHigh number of archaeal DNA MVs in HF suggests that they play a pathogenic role in worst evolution of CD. Elevated number of MVs containing AMZ1 and negative for archaeal DNA suggest that these MVs are removing collagenase, protecting against evolution to HF. These findings may bring a new therapeutic focus in Chagas’ diseasethe removal of infectious MVs.