Sequence evolution of SRY gene within Bovidae family

• Published in: Mammalian genome Vol. 5; no. 11; pp. 723 - 725
• Main Authors: Payen, E J, Cotinot, C Y
• Format: Journal Article
• Language: English
• Published: United States Springer Verlag 01-11-1994
• Subjects: Amino Acid Sequence; Animals; Base Sequence; Bison - genetics; Bison bonasus; Bos taurus; Bovidae; Capra hircus; Cattle - genetics; DNA-Binding Proteins - genetics; Genes; Goats - genetics; Life Sciences; Molecular Sequence Data; Nuclear Proteins; Ovis aries; Phylogeny; Ruminants - classification; Ruminants - genetics; Sequence Alignment; Sex-Determining Region Y Protein; Sheep - genetics; Species Specificity; Transcription Factors; SEQUENCE PROTEIQUE
• ISSN: 0938-8990; 1432-1777
• DOI: 10.1007/bf00426080

In mammals, male sex determination requires a dominant factor provided by the Y Chromosome (Chr). The SRY gene corresponds to this key factor and is conserved in mammalian species. The predicted amino acid sequence of SRY contains a central "high mobility group" domain (HMG-box) characteristic of a wide variety of DNA-binding proteins. This conserved motif represents a functional protein domain necessary for DNA-binding activity of SRY, and mutations in this area are responsible for sex inversion. In contrast, no function has been assigned to terminal regions of the SRY protein which are poorly conserved between species. Here, we investigated sequence evolution for the coding region of the SRY gene in ruminants (family Bovidae), and we compared the divergences inside two subfamilies: Bovinae and Caprinae. In previous work we cloned the HMG-box region of the sheep, cattle, and goat SRY gene. Using 5'-RACE from sheep testicular RNA, we isolated a 400-bp fragment that hybridizes specifically with SRY. This fragment was used to screen a male sheep genomic library, and an insert of 12 kb containing the sheep SRY gene was obtained and partially sequenced. From this sequence, oligonucleotide primers flanking the open reading frame (ORF) were defined to amplify genomic DNA from males and females of the Bovidae family. The PCR conditions were: 30 cycles of 94 degree C for 1 min, 52 degree C for 1 min, 72 degree C for 1 min with Taq polymerase (Cetus) and forward (5' TGCCAGGAGGTATTGAGGGG 3') and reverse primers (5' CAGAGGAGCAGTTATTTTGG 3'). The resulting male specific amplified fragments were cloned in the pBluescript vectors KS super(+) and sequenced. The sequences of four investigated species are available under the following accession numbers: Z30265 (sheep), Z30646 (goat), Z30327 (cattle), Z30321 (bison) [EMBL data bank]. The two members of the Caprinae subfamily (sheep and goat) possess the longest ORF: 723 bp against 690 bp for Bovinae. The length difference results in the position of the first ATG. Within the same subfamily, the homology percentage is very high: 99.4% in Bovinae (cattle, bison) and 97.1% in Caprinae (sheep, goat) on the whole ORF. In the Bovidae family the homology is less strong, 93.6% between sheep and cattle. Concerning the predicted amino acid sequences, data are summarized in Table 1 and Figure 1. The C-terminal non-box portion of SRY proteins is homogeneous in length among the investigated ruminants, although the N-terminal region is reduced by 11 amino acids in Bovinae. Nevertheless, we cannot exclude that all ruminant SRY proteins are of the same size and begin at the same ATG. SRY-predicted proteins of cattle and bison are very similar with only one nonsynonymous substitution located in the C-terminal region. Sequence homology (in percentage) between sheep and each of the other species was calculated for the various regions of the sequence. Sequence conservation is total within the HMG-box of sheep and goat. Outside this domain, concerning these two species, the N-terminus is the best conserved area of the protein. Bison (Bison bonasus), cattle (Bos taurus), sheep (Ovis aries), and goat (Capra hircus) show a high degree of similarity in regard to both their autosomal arms number (NF = 58) and the band patterns on most of their chromosomes. In sheep and goats, the Y Chr appears identical and has been reported as metacentric. In cattle and bison (B. bonasus), the Y Chr is larger (15 x 10 super(6) bp in sheep) and submetacentric.