Search Results - "de Marino, Simona"

Bioactive cembrane derivatives from the Indian Ocean soft coral, Sinularia kavarattiensis by Lillsunde, Katja-Emilia, Festa, Carmen, Adel, Harshada, De Marino, Simona, Lombardi, Valter, Tilvi, Supriya, Nawrot, Dorota A, Zampella, Angela, D'Souza, Lisette, D'Auria, Maria Valeria, Tammela, Päivi

“…Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances…”
Get full text

Oxygenated polyketides from Plakinastrella mamillaris as a new chemotype of PXR agonists by Festa, Carmen, D'Amore, Claudio, Renga, Barbara, Lauro, Gianluigi, De Marino, Simona, D'Auria, Maria Valeria, Bifulco, Giuseppe, Zampella, Angela, Fiorucci, Stefano

“…Further purification of the apolar extracts of the sponge Plakinastrella mamillaris, afforded a new oxygenated polyketide named gracilioether K, together with…”
Get full text

Identification of minor secondary metabolites from the latex of Croton lechleri (Muell-Arg) and evaluation of their antioxidant activity by De Marino, Simona, Gala, Fulvio, Zollo, Franco, Vitalini, Sara, Fico, Gelsomina, Visioli, Francesco, Iorizzi, Maria

“…Dragon's blood (Sangre de drago), a viscous red sap derived from Croton lechleri Muell-Arg (Euphorbiaceae), is extensively used by indigenous cultures of the…”
Get full text

Novel steroidal components from the underground parts of Ruscus aculeatus L by De Marino, Simona, Festa, Carmen, Zollo, Franco, Iorizzi, Maria

“…Two new furostanol saponins 1-2 and three new sulphated glycosides 3a,b and 4 were isolated from the underground parts of Ruscus aculeatus L., along with four…”
Get full text

Marine and semi-synthetic hydroxysteroids as new scaffolds for pregnane X receptor modulation by Sepe, Valentina, Di Leva, Francesco Saverio, D'Amore, Claudio, Festa, Carmen, De Marino, Simona, Renga, Barbara, D'Auria, Maria Valeria, Novellino, Ettore, Limongelli, Vittorio, D'Souza, Lisette, Majik, Mahesh, Zampella, Angela, Fiorucci, Stefano

“…In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation…”
Get full text

Swinholide J, a potent cytotoxin from the marine sponge Theonella swinhoei by De Marino, Simona, Festa, Carmen, D'Auria, Maria Valeria, Cresteil, Thierry, Debitus, Cecile, Zampella, Angela

“…In our ongoing search for new pharmacologically active leads from Solomon organisms, we have examined the sponge Theonella swinhoei. Herein we report the…”
Get full text

Differential in gel electrophoresis (DIGE) comparative proteomic analysis of macrophages cell cultures in response to perthamide C treatment by Vilasi, Annalisa, Monti, Maria Chiara, Tosco, Alessandra, De Marino, Simona, Margarucci, Luigi, Riccio, Raffaele, Casapullo, Agostino

“…Secondary metabolites contained in marine organisms disclose diverse pharmacological activities, due to their intrinsic ability to recognize…”
Get full text

Preliminary structure-activity relationship on theonellasterol, a new chemotype of FXR antagonist, from the marine sponge Theonella swinhoei by Sepe, Valentina, Ummarino, Raffaella, D'Auria, Maria Valeria, Taglialatela-Scafati, Orazio, Marino, Simona De, D'Amore, Claudio, Renga, Barbara, Chini, Maria Giovanna, Bifulco, Giuseppe, Nakao, Yoichi, Fusetani, Nobuhiro, Fiorucci, Stefano, Zampella, Angela

“…Using theonellasterol as a novel FXR antagonist hit, we prepared a series of semi-synthetic derivatives in order to gain insight into the structural…”
Get full text

Theonella : A Treasure Trove of Structurally Unique and Biologically Active Sterols by Festa, Carmen, De Marino, Simona, Zampella, Angela, Fiorucci, Stefano

“…The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the…”
Get full text

From marine neglected substrata new fungal taxa of potential biotechnological interest: the case of Pelagia noctiluca by Pasqualetti, Marcella, Braconcini, Martina, Barghini, Paolo, Gorrasi, Susanna, Schillaci, Domenico, Ferraro, Donatella, Della Sala, Gerardo, De Marino, Simona, Fenice, Massimiliano

“…The marine environment is extremely complex and exerts strong evolutionary pressure often leading to the appearance of microbial strains with new metabolic…”
Get full text

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists by Finamore, Claudia, Festa, Carmen, Fiorillo, Bianca, Leva, Francesco Saverio Di, Roselli, Rosalinda, Marchianò, Silvia, Biagioli, Michele, Spinelli, Lucio, Fiorucci, Stefano, Limongelli, Vittorio, Zampella, Angela, De Marino, Simona

“…Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand…”
Get full text

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction by Festa, Carmen, Esposito, Veronica, Benigno, Daniela, De Marino, Simona, Zampella, Angela, Virgilio, Antonella, Galeone, Aldo

“…The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for…”
Get full text

Phytochemical and Biological Studies of Nepeta asterotricha Rech. f. (Lamiaceae): Isolation of Nepetamoside by Goldansaz, Seyed Mostafa, Festa, Carmen, Pagano, Ester, De Marino, Simona, Finamore, Claudia, Parisi, Olga Alessandra, Borrelli, Francesca, Sonboli, Ali, D'Auria, Maria Valeria

“…The -butanolic extract, from an Iranian specimen of Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1…”
Get full text

Discovery of ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureidyl derivatives as selective non-steroidal agonists of the G-protein coupled bile acid receptor-1 by Di Leva, Francesco Saverio, Festa, Carmen, Carino, Adriana, De Marino, Simona, Marchianò, Silvia, Di Marino, Daniele, Finamore, Claudia, Monti, Maria Chiara, Zampella, Angela, Fiorucci, Stefano, Limongelli, Vittorio

“…The G-protein bile acid receptor 1 (GPBAR1) has emerged in the last decade as prominent target for the treatment of metabolic and inflammatory diseases…”
Get full text

Investigation around the Oxadiazole Core in the Discovery of a New Chemotype of Potent and Selective FXR Antagonists by Festa, Carmen, Finamore, Claudia, Marchianò, Silvia, Di Leva, Francesco Saverio, Carino, Adriana, Monti, Maria Chiara, del Gaudio, Federica, Ceccacci, Sara, Limongelli, Vittorio, Zampella, Angela, Fiorucci, Stefano, De Marino, Simona

“…Recent findings have shown that Farnesoid X Receptor (FXR) antagonists might be useful in the treatment of cholestasis and related metabolic disorders. In this…”
Get full text

Binding Mechanism of the Farnesoid X Receptor Marine Antagonist Suvanine Reveals a Strategy To Forestall Drug Modulation on Nuclear Receptors. Design, Synthesis, and Biological Evaluation of Novel Ligands by Di Leva, Francesco Saverio, Festa, Carmen, D’Amore, Claudio, De Marino, Simona, Renga, Barbara, D’Auria, Maria Valeria, Novellino, Ettore, Limongelli, Vittorio, Zampella, Angela, Fiorucci, Stefano

“…Here, we report suvanine, a marine sponge sesterterpene, as an antagonist of the mammalian bile acid sensor farnesoid-X-receptor (FXR). Using suvanine as a…”
Get full text

Antioxidant activity and chemical components as potential anticancer agents in the olive leaf (Olea europaea L. cv Leccino.) decoction by De Marino, Simona, Festa, Carmen, Zollo, Franco, Nini, Antonella, Antenucci, Lina, Raimo, Gennaro, Iorizzi, Maria

“…Epidemiological studies have shown that a reduced risk of chronic diseases such as cancer and cardiovascular diseases is correlated with a regular consumption…”
Get more information

Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp Futura 75 Cultivar: Isolation of a New Cannabinoid Derivative and Biological Profile Using Computational Approaches by De Vita, Simona, Finamore, Claudia, Chini, Maria Giovanna, Saviano, Gabriella, De Felice, Vincenzo, De Marino, Simona, Lauro, Gianluigi, Casapullo, Agostino, Fantasma, Francesca, Trombetta, Federico, Bifulco, Giuseppe, Iorizzi, Maria

“…Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ9-THC) concentration or for its fiber and…”
Get full text

BAR502/fibrate conjugates: synthesis, biological evaluation and metabolic profile by Finamore, Claudia, De Marino, Simona, Cassiano, Chiara, Napolitano, Giuliano, Rapacciuolo, Pasquale, Marchianò, Silvia, Biagioli, Michele, Roselli, Rosalinda, Di Giorgio, Cristina, Festa, Carmen, Fiorucci, Stefano, Zampella, Angela

“…BAR502, a bile acid analogue, is active as dual FXR/GPBAR1 agonist and represents a promising lead for the treatment of cholestasis and NASH. In this paper we…”
Get full text

Theonellasterols and Conicasterols from Theonella swinhoei. Novel Marine Natural Ligands for Human Nuclear Receptors by De Marino, Simona, Ummarino, Raffaella, D’Auria, Maria Valeria, Chini, Maria Giovanna, Bifulco, Giuseppe, Renga, Barbara, D’Amore, Claudio, Fiorucci, Stefano, Debitus, Cécile, Zampella, Angela

“…Silica gel column chromatography, followed by HPLC purification on the apolar fraction of the methanol extract of marine sponge Theonella swinhoei, resulted in…”
Get full text