Search Results - "Zloh, Mire"
-
1
An analysis of the ‘legal high’ mephedrone
Published in Bioorganic & medicinal chemistry letters (15-07-2010)“…Analysis of a sample of the methyl-cathinone derivative mephedrone (1) has led to the full unambiguous assignment of the spectral data for this compound…”
Get full text
Journal Article -
2
Deep Learning for Novel Antimicrobial Peptide Design
Published in Biomolecules (Basel, Switzerland) (22-03-2021)“…Antimicrobial resistance is an increasing issue in healthcare as the overuse of antibacterial agents rises during the COVID-19 pandemic. The need for new…”
Get full text
Journal Article -
3
Use of quercetin in animal feed: effects on the P-gp expression and pharmacokinetics of orally administrated enrofloxacin in chicken
Published in Scientific reports (13-03-2018)“…Modulation of P-glycoprotein (P-gp, encoded by Mdr1) by xenobiotics plays central role in pharmacokinetics of various drugs. Quercetin has a potential to…”
Get full text
Journal Article -
4
Design and Synthesis of Pyridyl and 2-Hydroxyphenyl Chalcones with Antitubercular Activity
Published in Molecules (Basel, Switzerland) (24-09-2024)“…A focussed library of pyridyl and 2-hydroxyphenyl chalcones were synthesized and tested for growth inhibitory activity against H37Rv, and normal and cancer…”
Get full text
Journal Article -
5
Evaluation of Encapsulation Potential of Selected Star-Hyperbranched Polyglycidol Architectures: Predictive Molecular Dynamics Simulations and Experimental Validation
Published in Molecules (Basel, Switzerland) (01-10-2023)“…Polymers, including non-linear copolymers, have great potential in the development of drug delivery systems with many advantages, but the design requires…”
Get full text
Journal Article -
6
Molecular Modeling to Study Dendrimers for Biomedical Applications
Published in Molecules (08-12-2014)“…Molecular modeling techniques provide a powerful tool to study the properties of molecules and their interactions at the molecular level. The use of…”
Get full text
Journal Article Book Review -
7
Inhibitory Effect of Berberine on Broiler P-glycoprotein Expression and Function: In Situ and In Vitro Studies
Published in International journal of molecular sciences (22-04-2019)“…Overcoming P-glycoprotein (P-gp) efflux is a strategy to improve the absorption and pharmacokinetics of its substrate drugs. Berberine inhibits P-gp and…”
Get full text
Journal Article -
8
Flavonoids from Artemisia rupestris and their synergistic antibacterial effects on drug-resistant Staphylococcus aureus
Published in Natural product research (03-06-2021)“…This study seeks to discover flavonoids from a traditional Chinese herb, Artemisia rupestris L., with synergistic antibacterial effects against…”
Get full text
Journal Article -
9
Synthesis and in Silico Modelling of the Potential Dual Mechanistic Activity of Small Cationic Peptides Potentiating the Antibiotic Novobiocin against Susceptible and Multi-Drug Resistant Escherichia coli
Published in International journal of molecular sciences (30-11-2020)“…Cationic antimicrobial peptides have attracted interest, both as antimicrobial agents and for their ability to increase cell permeability to potentiate other…”
Get full text
Journal Article -
10
3D-QSAR study of adenosine 5’-phosphosulfate (APS) analouges as ligands for APS reductase
Published in Journal of the Serbian Chemical Society (01-01-2021)“…Metabolism of sulfur (sulfur assimilation pathway, SAP) is one of the key pathways for the pathogenesis and survival of persistant bacteria, such as…”
Get full text
Journal Article -
11
Crystal Structure of a Promoter Sequence in the B‑raf Gene Reveals an Intertwined Dimer Quadruplex
Published in Journal of the American Chemical Society (26-12-2013)“…The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an…”
Get full text
Journal Article -
12
Relevance of Breast Cancer Resistance Protein to Pharmacokinetics of Florfenicol in Chickens: A Perspective from In Vivo and In Vitro Studies
Published in International journal of molecular sciences (15-10-2018)“…Florfenicol (FFC) is a valuable synthetic fluorinated derivative of thiamphenicol widely used to treat infectious diseases in food animals. The aims of the…”
Get full text
Journal Article -
13
Early detection of metabolic changes in drug-induced steatosis using metabolomics approaches
Published in RSC advances (11-11-2020)“…Steatosis is the accumulation of triglycerides in hepatic cells wherein fats exceed 5% of the entire liver weight. Although steatotic liver damage is…”
Get full text
Journal Article -
14
Detection of newly emerging psychoactive substances using Raman spectroscopy and chemometrics
Published in RSC advances (01-01-2018)“…A novel approach for the identification of New Psychoactive Substances (NPS) by means of Raman spectroscopy coupled with Principal Components Analysis (PCA)…”
Get full text
Journal Article -
15
In Silico Structural Evaluation of Short Cationic Antimicrobial Peptides
Published in Pharmaceutics (21-06-2018)“…Cationic peptides with antimicrobial properties are ubiquitous in nature and have been studied for many years in an attempt to design novel antibiotics…”
Get full text
Journal Article -
16
DFT study of the radical scavenging activity of isoxanthohumol, humulones (α-acids), and iso-α-acids from beer
Published in Structural chemistry (01-10-2021)“…Humulones and iso-humulones are potent natural antioxidants found in beer. In this study, density functional theory (DFT) method was applied for elucidating…”
Get full text
Journal Article -
17
Site-specific PEGylation of native disulfide bonds in therapeutic proteins
Published in Nature chemical biology (01-06-2006)“…Native disulfide bonds in therapeutic proteins are crucial for tertiary structure and biological activity and are therefore considered unsuitable for chemical…”
Get full text
Journal Article -
18
Drowning in diversity? A systematic way of clustering and selecting a representative set of new psychoactive substances
Published in RSC advances (2017)“…New psychoactive substances (NPS) can be generally described as a set of compounds that have been designed to mimic the effects of illegal recreational drugs,…”
Get full text
Journal Article -
19
Identification of Protein-Excipient Interaction Hotspots Using Computational Approaches
Published in International journal of molecular sciences (01-06-2016)“…Protein formulation development relies on the selection of excipients that inhibit protein-protein interactions preventing aggregation. Empirical strategies…”
Get full text
Journal Article -
20
VEGFA, B, C: Implications of the C-Terminal Sequence Variations for the Interaction with Neuropilins
Published in Biomolecules (Basel, Switzerland) (26-02-2022)“…Vascular endothelial growth factors (VEGFs) are the key regulators of blood and lymphatic vessels' formation and function. Each of the proteins from the…”
Get full text
Journal Article