Search Results - "Virgilio, Antonella"

Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway by Esposito, Veronica, Benigno, Daniela, Bello, Ivana, Panza, Elisabetta, Bucci, Mariarosaria, Virgilio, Antonella, Galeone, Aldo

“…In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3…”
Get full text

Human AP-endonuclease (Ape1) activity on telomeric G4 structures is modulated by acetylatable lysine residues in the N-terminal sequence by Burra, Silvia, Marasco, Daniela, Malfatti, Matilde Clarissa, Antoniali, Giulia, Virgilio, Antonella, Esposito, Veronica, Demple, Bruce, Galeone, Aldo, Tell, Gianluca

“…[Display omitted] •The G-rich regions of telomeres are hotspots for oxidation which is handled by BER pathway.•Ape1 exerts an important role in telomeric…”
Get full text

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTG2T(G3T)3] and Its Derivatives with an Abasic Site Replacing Single Thymidine by Virgilio, Antonella, Benigno, Daniela, Pecoraro, Annalisa, Russo, Annapina, Russo, Giulia, Esposito, Veronica, Galeone, Aldo

“…In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in…”
Get full text

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2′-Deoxyguanosine and 2′-Substituted RNA Analogues by Virgilio, Antonella, Benigno, Daniela, Aliberti, Carla, Vellecco, Valentina, Bucci, Mariarosaria, Esposito, Veronica, Galeone, Aldo

“…Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can…”
Get full text

Antiproliferative Effects of the Aptamer d(GGGT) 4 and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells by Virgilio, Antonella, Pecoraro, Annalisa, Benigno, Daniela, Russo, Annapina, Russo, Giulia, Esposito, Veronica, Galeone, Aldo

“…In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing…”
Get full text

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction by Festa, Carmen, Esposito, Veronica, Benigno, Daniela, De Marino, Simona, Zampella, Angela, Virgilio, Antonella, Galeone, Aldo

“…The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for…”
Get full text

MiR-34a targeting of Notch ligand delta-like 1 impairs CD15+/CD133+ tumor-propagating cells and supports neural differentiation in medulloblastoma by de Antonellis, Pasqualino, Medaglia, Chiara, Cusanelli, Emilio, Andolfo, Immacolata, Liguori, Lucia, De Vita, Gennaro, Carotenuto, Marianeve, Bello, Annamaria, Formiggini, Fabio, Galeone, Aldo, De Rosa, Giuseppe, Virgilio, Antonella, Scognamiglio, Immacolata, Sciro, Manuela, Basso, Giuseppe, Schulte, Johannes H, Cinalli, Giuseppe, Iolascon, Achille, Zollo, Massimo

“…Through negative regulation of gene expression, microRNAs (miRNAs) can function as oncosuppressors in cancers, and can themselves show altered expression in…”
Get full text

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads by Benigno, Daniela, Virgilio, Antonella, Bello, Ivana, La Manna, Sara, Vellecco, Valentina, Bucci, Mariarosaria, Marasco, Daniela, Panza, Elisabetta, Esposito, Veronica, Galeone, Aldo

“…In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two…”
Get full text

Site-specific replacement of the thymine methyl group by fluorine in thrombin binding aptamer significantly improves structural stability and anticoagulant activity by Virgilio, Antonella, Petraccone, Luigi, Vellecco, Valentina, Bucci, Mariarosaria, Varra, Michela, Irace, Carlo, Santamaria, Rita, Pepe, Antonietta, Mayol, Luciano, Esposito, Veronica, Galeone, Aldo

“…Here we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy, molecular modelling, differential scanning calorimetry and…”
Get full text

uL3 Mediated Nucleolar Stress Pathway as a New Mechanism of Action of Antiproliferative G-quadruplex TBA Derivatives in Colon Cancer Cells by Pecoraro, Annalisa, Virgilio, Antonella, Esposito, Veronica, Galeone, Aldo, Russo, Giulia, Russo, Annapina

“…The antiproliferative G-quadruplex aptamers are a promising and challenging subject in the framework of the anticancer therapeutic oligonucleotides research…”
Get full text

Strand directionality affects cation binding and movement within tetramolecular G-quadruplexes by Šket, Primoz, Virgilio, Antonella, Esposito, Veronica, Galeone, Aldo, Plavec, Janez

“…Nuclear magnetic resonance study of G-quadruplex structures formed by d(TG(3)T) and its modified analogs containing a 5'-5' or 3'-3' inversion of polarity…”
Get full text

Probing the Importance of the G-Quadruplex Grooves for the Activity of the Anti-HIV-Integrase Aptamer T30923 by Esposito, Veronica, Esposito, Francesca, Pepe, Antonietta, Gomez Monterrey, Isabel, Tramontano, Enzo, Mayol, Luciano, Virgilio, Antonella, Galeone, Aldo

“…In this paper, we report studies concerning four variants of the G-quadruplex forming anti-HIV-integrase aptamer T30923, in which specific 2'-deoxyguanosines…”
Get full text

A straightforward modification in the thrombin binding aptamer improving the stability, affinity to thrombin and nuclease resistance by Esposito, Veronica, Scuotto, Maria, Capuozzo, Antonella, Santamaria, Rita, Varra, Michela, Mayol, Luciano, Virgilio, Antonella, Galeone, Aldo

“…Degradation of nucleic acids in biological environments is the major drawback of the therapeutic use of aptamers. Among the approaches used to circumvent this…”
Get more information

Improvement of the activity of the anti-HIV-1 integrase aptamer T30175 by introducing a modified thymidine into the loops by Virgilio, Antonella, Amato, Teresa, Petraccone, Luigi, Esposito, Francesca, Grandi, Nicole, Tramontano, Enzo, Romero, Raquel, Haider, Shozeb, Gomez-Monterrey, Isabel, Novellino, Ettore, Mayol, Luciano, Esposito, Veronica, Galeone, Aldo

“…In this paper, we report our investigations on analogues of the anti-human immunodeficiency virus type 1 (HIV-1) integrase (IN) aptamer T30175 in which the…”
Get full text

Aptamers against the β-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric (Intra)Molecular DNA G-Quadruplex by Sullivan, Ciara K O', Mairal, Teresa, Jauset-Rubio, Miriam, Svobodova, Marketa, Skouridou, Vasso, Esposito, Veronica, Virgilio, Antonella, Galeone, Aldo

“…In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, β-conglutin and truncated to an 11-mer, improving the affinity by two orders…”
Get full text

5-Hydroxymethyl-2′-Deoxyuridine Residues in the Thrombin Binding Aptamer: Investigating Anticoagulant Activity by Making a Tiny Chemical Modification by Virgilio, Antonella, Petraccone, Luigi, Scuotto, Maria, Vellecco, Valentina, Bucci, Mariarosaria, Mayol, Luciano, Varra, Michela, Esposito, Veronica, Galeone, Aldo

“…We report an investigation into analogues of the thrombin binding aptamer (TBA). Individual thymidines were replaced by the unusual residue…”
Get full text

The insertion of two 8-methyl-2′-deoxyguanosine residues in tetramolecular quadruplex structures: trying to orientate the strands by Virgilio, Antonella, Esposito, Veronica, Citarella, Giuseppe, Pepe, Antonietta, Mayol, Luciano, Galeone, Aldo

“…In this article, we report a structural study, based on NMR and CD spectroscopies, and molecular modelling of all possible d(TG3T) and d(TG4T) analogues…”
Get full text

The Introduction of Inversion of Polarity Sites in DNA G-Quadruplex Structures: Effects and Perspectives by Virgilio, Antonella, Esposito, Veronica, Filosa, Rosanna, Mayol, Luciano, Galeone, Aldo

“…The natural sequences of nucleic acids generally consist of nucleotides linked together by canonical 3'-5' phosphodiester bonds. An inversion of polarity site…”
Get more information

miR-125b Upregulates miR-34a and Sequentially Activates Stress Adaption and Cell Death Mechanisms in Multiple Myeloma by Misso, Gabriella, Zarone, Mayra Rachele, Lombardi, Angela, Grimaldi, Anna, Cossu, Alessia Maria, Ferri, Carmela, Russo, Margherita, Vuoso, Daniela Cristina, Luce, Amalia, Kawasaki, Hiromichi, Di Martino, Maria Teresa, Virgilio, Antonella, Festa, Agostino, Galeone, Aldo, De Rosa, Giuseppe, Irace, Carlo, Donadelli, Massimo, Necas, Alois, Amler, Evzen, Tagliaferri, Pierosandro, Tassone, Pierfrancesco, Caraglia, Michele

“…miR-125b, ubiquitously expressed and frequently dysregulated in several tumors, has gained special interest in the field of cancer research, displaying either…”
Get full text

The “Janus face” of the thrombin binding aptamer: Investigating the anticoagulant and antiproliferative properties through straightforward chemical modifications by Esposito, Veronica, Russo, Annapina, Amato, Teresa, Vellecco, Valentina, Bucci, Mariarosaria, Mayol, Luciano, Russo, Giulia, Virgilio, Antonella, Galeone, Aldo

“…[Display omitted] •TBA analogues with 5-Br uracil in positions 4 or 13 show enhanced stabilities.•TBA analogues with uracil in positions 4 or 13 show improved…”
Get full text