Search Results - "Torres, T. M."

Design of a strong S-box based on a matrix approach by Aboytes-González, J. A., Murguía, J. S., Mejía-Carlos, M., González-Aguilar, H., Ramírez-Torres, M. T.

“…In this paper, we present a matrix approach based on the rule 90 cellular automata, and a fractional linear transformation over Galois field G F ( 2 8 ) , to…”
Get full text

Scaling Analysis of an Image Encryption Scheme Based on Chaotic Dynamical Systems by Reyes-López, L. E., Murguía, J. S., González-Aguilar, H., Ramírez-Torres, M. T., Mejía-Carlos, M., Armijo-Correa, J. O.

“…Despite that many image encryption systems based on chaotic or hyperchaotic systems have been proposed to protect different kinds of information, it has been…”
Get full text

Meningococcal carriage prevalence in university students, 1824 years of age in Santiago, Chile by Rodriguez, P, Alvarez, I, Torres, M.T, Diaz, J, Bertoglia, M.P, Carcamo, M, Seoane, M, Araya, P, Russo, M, Santolaya, M.E

“…Highlights • Prevalence of local meningococcal pharyngeal carriage in healthy Chilean university students was studied. • Our prevalence results showed a 4%…”
Get full text

Association between rs61764370, rs9266, and rs140080026 polymorphisms of the KRAS gene and breast cancer risk in a Mexican population by Gallegos-Arreola, M P, García Verdín, P M, Magaña-Torres, M T, Figuera, L E, Zúñiga-González, G M, Rosales-Reynoso, M A, Gómez-Meda, B C, Puebla-Pérez, A M

“…Polymorphisms of the KRAS gene have been shown to be associated with cancer. However, their association with breast cancer (BC) has been inconsistent. The…”
Get more information

Object Detection in Aerial Navigation using Wavelet Transform and Convolutional Neural Networks: A First Approach by Fortuna-Cervantes, J. M., Ramírez-Torres, M. T., Martínez-Carranza, J., Murguía-Ibarra, J. S., Mejía-Carlos, M.

“…This paper proposes a first approach based on wavelet analysis inside image processing for object detection with a repetitive pattern and binary classification…”
Get full text

The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer by Vázquez-Ibarra, K C, Bustos-Carpinteyro, A R, García-Ruvalcaba, A, Magaãa-Torres, M T, Gutiérrez-Aguilar, R, Marín-Contreras, M E, Santiago-Luna, E, Sánchez-López, J Y

“…Gastric cancer (GC) is the third most lethal type of cancer worldwide. Single nucleotide polymorphisms (SNPs) in regulatory sites or coding regions can modify…”
Get full text

Comment on ‘Childhood leukaemia close to high-voltage power lines – the Geocap study, 2002–2007’ – Odds ratio and confidence interval by Torres, M T Magaña, Garcia, J R Gonzalez

Get full text

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients by Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.

“…Introduction Beta‐thalassemia (β‐thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the…”
Get full text

Association between the CDH1-472delA and -160C>A polymorphisms and diffuse and intestinal gastric cancer in a Mexican population by Bustos-Carpinteyro, A R, Delgado-Figueroa, N, Santiago-Luna, E, Magaña-Torres, M T, Sánchez-López, J Y

“…Gastric cancer (GC), the third leading cause of cancer-related deaths in Mexico and worldwide, can be classified into diffuse (DGC) or intestinal (IGC) types…”
Get full text

Determination of SCN1A genetic variants in Mexican patients with refractory epilepsy and Dravet syndrome by Jiménez-Arredondo, R E, Brambila-Tapia, A J L, Mercado-Silva, F M, Magaña-Torres, M T, Figuera, L E

“…Mutations in the SCN1A gene can result in syndromes associated with epilepsy, including the Dravet syndrome (DS). However, the prevalence of such mutations in…”
Get full text

Resource utilisation and cost of ankylosing spondylitis in Brazil by TORRES, T. M, FERRAZ, M. B, CICONELLI, R. M

“…The present study describes resource utilisation in patients with ankylosing spondylitis (AS) treated at a tertiary public health facility over a one-year…”
Get full text

5′ and 3′ β-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups by Casas-castañeda, M., Ibarra, B., Rizo-De La Torre, L.C., Sánchez-López, J.Y., Magaña-Torres, M.T.

“…Objective The purpose of this study was to determine the β‐globin cluster haplotype variability of two Mexican indigenous groups—Purepechas (PUR) and…”
Get full text

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population by Torres-Jasso, J H, Marín, M E, Santiago-Luna, E, Leoner, J C, Torres, J, Magaña-Torres, M T, Perea, F J, Ibarra, B, Sánchez-López, J Y

“…Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular…”
Get full text

Combining LCT tools for the optimization of an industrial process: Material and energy flow analysis and best available techniques by Rodríguez, M.T. Torres, Andrade, L. Cristóbal, Bugallo, P.M. Bello, Long, J.J. Casares

“…► Combining life cycle thinking tools for the optimization of an industrial process. ► Development of a methodology combining material and energy flow analysis…”
Get full text

Reproductive Response of Ewes Fed with Taiwan Grass Hay (Pennisetum purpureum Schum.) Supplemented with Duckweed (Lemna sp. and Spirodela sp.) by Zetina-Córdoba, P, Ortega-Cerrilla, M E, Sánchez Torres-Esqueda, M T, Herrera-Haro, J G, Ortega-Jiménez, E, Reta-Mendiola, J L, Vilaboa-Arroniz, J

“…The effect of duckweed (DW) supplementation was evaluated on dry matter intake (DMI), presence and duration of estrus, percentage of ewes repeating estrus and…”
Get full text

Gaining insight in the behaviour of imidazolium-based ionic liquids as additives in reversed-phase liquid chromatography for the analysis of basic compounds by Ubeda-Torres, M.T., Ortiz-Bolsico, C., García-Alvarez-Coque, M.C., Ruiz-Angel, M.J.

“…•Enhancement of HPLC performance for basic compounds with additives is studied.•The effect on retention and peak shape with ionic liquids and amines is…”
Get full text

Dup-24 bp in the CHIT1 Gene in Six Mexican Amerindian Populations by Da Silva-José, T. D., Juárez-Rendón, K. J., Juárez-Osuna, J. A., Porras-Dorantes, A., Valladares-Salgado, A., Cruz, M., Gonzalez-Ibarra, M., Soto, A. G., Magaña-Torres, M. T., Sandoval-Ramírez, L., García-Ortiz, José Elías

“…Chitotriosidase (CHIT, EC 3.2.1.14) is an enzyme secreted by activated macrophages with the ability to hydrolyze the chitin of pathogens. The high activity of…”
Get full text

Effect of surgical treatment on the survival in patients with malignant pleural mesothelioma by Baez-Saldana, R., Marmolejo-Torres, M.T., Iñiguez-García, M., Berrios Mejía, J.A., Rumbo-Nava, U., Arrieta-Rodríguez, O.

Get full text

Extraction of protease from Aspergillus tamarii URM 4634 in aqueous two-phase system under continuous and discontinuous process by Siqueira, J. G. W., Torres, T. M. S., Alves, B. M. V., Porto, A. L. F., Porto, T. S.

“…Aqueous two-phase systems have been studied for almost a century to separate biomolecules in harmless conditions. Proteases produced by Aspergillus tamarii URM…”
Get full text

Perceptual security of encrypted images based on wavelet scaling analysis by Vargas-Olmos, C., Murguía, J.S., Ramírez-Torres, M.T., Mejía Carlos, M., Rosu, H.C., González-Aguilar, H.

“…The scaling behavior of the pixel fluctuations of encrypted images is evaluated by using the detrended fluctuation analysis based on wavelets, a modern…”
Get full text