Search Results - "Tendler, Saul B"

Controlling the Physical Dimensions of Peptide Nanotubes by Supramolecular Polymer Coassembly by Adler-Abramovich, Lihi, Marco, Pini, Arnon, Zohar A, Creasey, Rhiannon C. G, Michaels, Thomas C. T, Levin, Aviad, Scurr, David J, Roberts, Clive J, Knowles, Tuomas P. J, Tendler, Saul J. B, Gazit, Ehud

“…Molecular self-assembly of peptides into ordered nanotubes is highly important for various technological applications. Very short peptide building blocks, as…”
Get full text

Thermal and Chemical Stability of Diphenylalanine Peptide Nanotubes:  Implications for Nanotechnological Applications by Adler-Abramovich, Lihi, Reches, Meital, Sedman, Victoria L, Allen, Stephanie, Tendler, Saul J. B, Gazit, Ehud

“…The diphenylalanine peptide, the core recognition motif of the β-amyloid polypeptide, efficiently self-assembles into discrete, well-ordered nanotubes. Here,…”
Get full text

Investigations of the Supramolecular Structure of Individual Diphenylalanine Nano- and Microtubes by Polarized Raman Microspectroscopy by Lekprasert, Banyat, Korolkov, Vladimir, Falamas, Alexandra, Chis, Vasile, Roberts, Clive J, Tendler, Saul J. B, Notingher, Ioan

“…Polarized Raman microspectroscopy and atomic force microscopy were used to obtain quantitative information regarding the molecular structure of individual…”
Get full text

Using the Bending Beam Model to Estimate the Elasticity of Diphenylalanine Nanotubes by Niu, Lijiang, Chen, Xinyong, Allen, Stephanie, Tendler, Saul J. B

“…The core recognition motif of the amyloidogenic β-amyloid polypeptide, diphenylalanine peptide, has previously been shown to self-assemble into discrete,…”
Get full text

Direct Observation of the Release of Phenylalanine from Diphenylalanine Nanotubes by Sedman, Victoria L, Adler-Abramovich, Lihi, Allen, Stephanie, Gazit, Ehud, Tendler, Saul J. B

“…The core recognition motif of the amyloidogenic β-amyloid polypeptide is a dipeptide of phenylalanine. This dipeptide readily self-assembles to form discrete,…”
Get full text

Ferritin-Based New Magnetic Force Microscopic Probe Detecting 10 nm Sized Magnetic Nanoparticles by Kim, Duckhoe, Chung, Nak-Kwan, Allen, Stephanie, Tendler, Saul J. B, Park, Joon Won

“…A single-molecule ferritin picking-up process was realized with the use of AFM, which was enhanced by employing controlled dendron surface chemistry. The…”
Get full text

Formaldehyde at low concentration induces protein tau into globular amyloid-like aggregates in vitro and in vivo by Nie, Chun Lai, Wei, Yan, Chen, Xinyong, Liu, Yan Ying, Dui, Wen, Liu, Ying, Davies, Martyn C, Tendler, Saul J B, He, Rong Giao

“…Recent studies have shown that neurodegeneration is closely related to misfolding and aggregation of neuronal tau. Our previous results show that neuronal tau…”
Get full text

Dendron Arrays for the Force-Based Detection of DNA Hybridization Events by Jung, Yu Jin, Hong, Bong Jin, Zhang, Wenke, Tendler, Saul J. B, Williams, Philip M, Allen, Stephanie, Park, Joon Won

“…Single-molecule force measurement methods have attracted increasing interest over recent years for the development of novel approaches for biomolecular…”
Get full text

The structure and formation of hydrogen-bonded molecular networks on Au(111) surfaces revealed by scanning tunnelling and torsional-tapping atomic force microscopy by Korolkov, Vladimir V, Mullin, Nic, Allen, Stephanie, Roberts, Clive J, Hobbs, Jamie K, Tendler, Saul J B

“…A comprehensive scanning probe microscopy study has been carried out to characterise 3,4,9,10-Perylenetetracarboxylic diimide (PTCDI)-melamine hydrogen-bonded…”
Get more information

Real-time measurement of the intracellular pH of yeast cells during glucose metabolism using ratiometric fluorescent nanosensors by Elsutohy, Mohamed M, Chauhan, Veeren M, Markus, Robert, Kyyaly, Mohammed Aref, Tendler, Saul J B, Aylott, Jonathan W

“…Intracellular pH is a key parameter that influences many biochemical and metabolic pathways that can also be used as an indirect marker to monitor metabolic…”
Get more information

The Development, Characterization, and Demonstration of a Versatile Immobilization Strategy for Biomolecular Force Measurements by Stevens, Molly M, Allen, Stephanie, Davies, Martyn C, Roberts, Clive J, Schacht, Etienne, Tendler, Saul J. B, VanSteenkiste, Stefan, Williams, Philip M

“…Biomolecular force measurements, obtained for example using atomic force microscopy (AFM), can provide valuable molecular-level information on the interactions…”
Get full text

Influence of Architecture on the Kinetic Stability of Molecular Assemblies by Patel, Amesh B, Allen, Stephanie, Davies, Martyn C, Roberts, Clive J, Tendler, Saul J. B, Williams, Philip M

“…The strength of a multimolecular system depends on the number of interactions that hold it together. Using dynamic force spectroscopy, we show how the kinetic…”
Get full text

Bimolecular porous supramolecular networks deposited from solution on layered materials: graphite, boron nitride and molybdenum disulphide by Korolkov, Vladimir V, Svatek, Simon A, Allen, Stephanie, Roberts, Clive J, Tendler, Saul J B, Taniguchi, Takashi, Watanabe, Kenji, Champness, Neil R, Beton, Peter H

“…A two-dimensional porous network formed from perylene tetracarboxylic diimide (PTCDI) and melamine may be deposited from solution on the surfaces of highly…”
Get more information

Near-field Raman spectroscopy of biological nanomaterials by in situ laser-induced synthesis of tip-enhanced Raman spectroscopy tips by Sinjab, Faris, Lekprasert, Banyat, Woolley, Richard A J, Roberts, Clive J, Tendler, Saul J B, Notingher, Ioan

“…We report a new approach in tip-enhanced Raman spectroscopy (TERS) in which TERS-active tips with enhancement factors of ∼10(-5)× can be rapidly (1-3 min)…”
Get more information

Probing DNA Duplex Formation and DNA−Drug Interactions by the Quartz Crystal Microbalance Technique by Pope, Lisa H, Allen, Stephanie, Davies, Martyn C, Roberts, Clive J, Tendler, Saul J. B, Williams, Philip M

“…The detection of duplex formation for tethered films of 12-mer (d(CGCAAAAAAGCG)) and 34-mer ((d(GCGTTCATTGTGGTGATATGTGCGCAAAAAAGCG)) oligonucleotides and of…”
Get full text

Thermomechanical Manipulation of Aromatic Peptide Nanotubes by Sedman, Victoria L, Allen, Stephanie, Chen, Xinyong, Roberts, Clive J, Tendler, Saul J. B

“…Self-assembling aromatic dipeptides are among the smallest known biological materials which readily form ordered nanostructures. The simplicity of nanotube…”
Get full text

Reply to the 'Comment on "The structure and formation of hydrogen-bonded molecular networks on Au(111) surfaces revealed by scanning tunnelling and torsional-tapping atomic force microscopy"' by I. Cebula, M. T. Räisänen, R. Madueno, B. Karamzadeh and M. Buck, Phys. Chem. Chem. Phys., 2013, 15, DOI: 10.1039/c3cp50754h by Korolkov, Vladimir V, Mullin, Nic, Allen, Stephanie, Roberts, Clive J, Hobbs, Jamie K, Tendler, Saul J B

Get more information

Surface mediated L-phenylalanyl-L-phenylalanine assembly into large dendritic structures by Korolkov, Vladimir V, Allen, Stephanie, Roberts, Clive J, Tendler, Saul J B

“…We report a new class of dipeptide dendritic structures fabricated on the surface of mica via spin casting and the conditions required to achieve them. Both…”
Get more information

Study of NAP adsorption and assembly on the surface of HOPG by Korolkov, Vladimir V., Allen, Stephanie, Roberts, Clive J., Gozes, Illana, Tendler, Saul J.B.

“…NAP is an octapeptide that has demonstrated a neuroprotective/therapeutic efficacy at very low concentrations in preclinical studies and in a number of…”
Get full text

Immobilization of Protein Molecules onto Homogeneous and Mixed Carboxylate-Terminated Self-Assembled Monolayers by Patel, Nikin, Davies, Martyn C, Hartshorne, Mark, Heaton, Richard J, Roberts, Clive J, Tendler, Saul J. B, Williams, Philip M

“…The attachment of biomolecules, in particular proteins, onto solid supports is fundamental in the development of advanced biosensors, bioreactors, affinity…”
Get full text