Search Results - "Renda, E"

Intraplate deformation during Gondwana breakup: a study of the Jurassic units of the Cañadón Asfalto Basin (extra-Andean Patagonia, Argentina) by Ruiz González, V, Renda, E M, Vizán, H, Martín-Hernández, F, Palencia-Ortas, A, Osete, M L

“…SUMMARY In this study, we present the results of palaeomagnetic research conducted on Jurassic units of the Cañadón Asfalto Basin (CAB) in Patagonia, formed…”
Get full text

Deformation along the Deseado Massif (Patagonia, Argentina) during the Jurassic Period and its relationship with the Gondwana breakup: paleomagnetic and geochronological constraints by Ruiz González, V., Renda, E.M., Vizán, H., Ganerød, M., Puigdomenech, C.G., Zaffarana, C.B.

“…This work presents the analysis of paleomagnetic results obtained from four sampling areas of the Jurassic Bahía Laura Complex in the Deseado Massif and their…”
Get full text

Paleomagnetic data from the Precordillera of northern Chile: A multiphase rotation history related to a multiphase deformational history by Puigdomenech, C., Somoza, R., Tomlinson, A., Renda, E.M.

“…One of the most conspicuous features of the Andean chain is the change in its trajectory from NW-SE to N-S at 18°S known as the Bolivian Orocline. Although the…”
Get full text

High level of hemoglobin, white blood cells and obesity among Sudanese women in early pregnancy: a cross-sectional study by Elmugabil, Abdelmageed, Rayis, Duria A, Abdelmageed, Renda E, Adam, Ishag, Gasim, Gasim I

“…To investigate the association between obesity and anemia/hemoglobin levels. A cross-sectional study was conducted at Khartoum, Sudan. Obstetric data were…”
Get full text

Symptomatic first-degree atrioventricular block in a young woman after taking a fat burner supplement by Abdelmageed, Renda E M, Xiao, H B

“…A 22-year-old woman collapsed at home and was brought to the accident and emergency department. History revealed that she was fit and taken T5 capsule the…”
Get full text

Evolution of the Paleozoic Claromecó Basin (Argentina) and geodynamic implications for the southwestern margin of Gondwana: Insights from isostatic, gravimetric and magnetometric models by Prezzi, C.B., Vizán, H., Vázquez, S., Renda, E., Oriolo, S., Japas, M.S.

“…The evolution of the Paleozoic Claromecó Basin is intimately related to contemporaneous tectonic events in the Sierras Australes and Patagonia (Argentina)…”
Get full text

Tectonophysics Evolution of the Paleozoic Claromecó Basin (Argentina) and geodynamic implications for the southwestern margin of Gondwana: Insights from isostatic, gravimetric and magnetometric models by Prezzi, C B, Vizán, H, Vázquez, S, Renda, E, Oriolo, S, Japas, M S

“…The evolution of the Paleozoic Claromecó Basin is intimately related to contemporaneous tectonic events in the Sierras Australes and Patagonia (Argentina)…”
Get full text

High serum calcitonin levels in heroin addicts by TAGLIARO, F, CAPRA, F, DORIZZI, R, LUISETTO, G, ACCORDINI, A, RENDA, E, PAROLIN, A

“…An involvement of calcitonin in the mechanism of pain perception has recently been hypothesized. In order to collect information about the relationship between…”
Get full text

Load Balancing Hashing in Geographic Hash Tables by Renda, M. E., Resta, G., Santi, P.

“…In this paper, we address the problem of balancing the network traffic load when the data generated in a wireless sensor network is stored on the sensor node…”
Get full text

Symptomatic first-degree atrioventricular block in a young woman after taking a fat burner supplement by Abdelmageed, Renda E M, Xiao, H B

Get full text

Pulmonary Valve Replacement After Operative Repair of Tetralogy of Fallot: Meta-Analysis and Meta-Regression of 3,118 Patients From 48 Studies by FERRAZ CAVALCANTI, Paulo Ernando, BARROS OLIVEIRA SA, Michel Pompeu, ANDRADE SANTOS, Cecilia, MELO ESMERALDO, Isaac, RENDA DE ESCOBAR, Rodrigo, MOTTA DE MENEZES, Alexandre, MORAIS DE AZEVEDO, Orlando, PIRES DE VASCONCELOS SILVA, Frederico, DE ALBUQUERQUE LINS, Ricardo Felipe, LIMA, Ricardo de Carvalho

“…Because the real benefit of pulmonary valve replacement (PVR) in patients with repaired tetralogy of Fallot who develop pulmonary insufficiency remains…”
Get full text

Separation of G structures formed by a 27-mer guanosine-rich oligodeoxyribonucleotide by dye–ligand affinity chromatography by Alberghina, Gaetano, Fisichella, Salvatore, Renda, Emanuela

“…G-DNA structures, formed by a 27-mer guanosine-rich oligodeoxyribonucleotide, AACCCGGCGTTCGGGGGGTACCGGGTT, were isolated and studied by dye–ligand affinity…”
Get full text

Realizing the Equity-Minded Aspirations of Detracking and Inclusion: Toward a Capacity-Oriented Framework for Teacher Education by Renda Abu El-Haj, Thea, Rubin, Beth C.

“…Inclusion and detracking policies seek to remedy the pervasive inequality of educational opportunities in U.S. schools by building classrooms that are…”
Get full text

AMIC@: All MIcroarray Clusterings @ once by Geraci, Filippo, Pellegrini, Marco, Renda, M. Elena

“…The AMIC@ Web Server offers a light-weight multi-method clustering engine for microarray gene-expression data. AMIC@ is a highly interactive tool that stresses…”
Get full text

Measuring VoIP Performance in IEEE 802.11P Vehicular Networks by Martelli, F., Renda, M. E., Santi, P., Volpetti, M.

“…This paper studies, for the first time to our best knowledge, VoIP performance over V2V IEEE 802.11p links. VoIP performance is evaluated in terms of both…”
Get full text

A personalized collaborative Digital Library environment: a model and an application by Renda, M.Elena, Straccia, Umberto

“…The Web, and consequently the information contained in it, is growing rapidly. Every day a huge amount of newly created information is electronically published…”
Get full text

K-Boost: a scalable algorithm for high-quality clustering of microarray gene expression data by Geraci, Filippo, Leoncini, Mauro, Montangero, Manuela, Pellegrini, Marco, Renda, M Elena

“…Microarray technology for profiling gene expression levels is a popular tool in modern biological research. Applications range from tissue classification to…”
Get more information