Search Results - "Parkinson, G."

Effect of insoluble fiber supplementation applied at different ages on digestive organ weight and digestive enzymes of layer-strain poultry by Yokhana, J. S., Parkinson, G., Frankel, T. L.

“…Two experiments were conducted to study effects of dietary insoluble fiber (IF) on digestive enzyme function in layer poultry. In Experiment 1, 8 wk old…”
Get full text

Subsurface cation vacancy stabilization of the magnetite (001) surface by Bliem, R., McDermott, E., Ferstl, P., Setvin, M., Gamba, O., Pavelec, J., Schneider, M. A., Schmid, M., Diebold, U., Blaha, P., Hammer, L., Parkinson, G. S.

“…Iron oxides play an increasingly prominent role in heterogeneous catalysis, hydrogen production, spintronics, and drug delivery. The surface or material…”
Get full text

Granzyme B mediates both direct and indirect cleavage of extracellular matrix in skin after chronic low‐dose ultraviolet light irradiation by Parkinson, Leigh G., Toro, Ana, Zhao, Hongyan, Brown, Keddie, Tebbutt, Scott J., Granville, David J.

“…Summary Extracellular matrix (ECM) degradation is a hallmark of many chronic inflammatory diseases that can lead to a loss of function, aging, and disease…”
Get full text

Raman chemometric urinalysis (Rametrix) as a screen for bladder cancer by Huttanus, Herbert M, Vu, Tommy, Guruli, Georgi, Tracey, Andrew, Carswell, William, Said, Neveen, Du, Pang, Parkinson, Bing G, Orlando, Giuseppe, Robertson, John L, Senger, Ryan S

“…Bladder cancer (BCA) is relatively common and potentially recurrent/progressive disease. It is also costly to detect, treat, and control. Definitive diagnosis…”
Get full text

Changes in mental state and behaviour in Huntington's disease by Eddy, Clare M, PhD, Parkinson, Ellice G, MSc, Rickards, Hugh E, Prof

“…Summary Changes in mental state and behaviour have been acknowledged in Huntington's disease since the original monograph in 1872 provided evidence of…”
Get full text

Serpina3n accelerates tissue repair in a diabetic mouse model of delayed wound healing by Hsu, I, Parkinson, L G, Shen, Y, Toro, A, Brown, T, Zhao, H, Bleackley, R C, Granville, D J

“…Chronic, non-healing wounds are a major complication of diabetes and are characterized by chronic inflammation and excessive protease activity. Although once…”
Get full text

Alternatives to formulate laying hen diets beyond the traditional least-cost model by Moss, A.F., Parkinson, G., Crowley, T.M., Pesti, G.M.

“…Owing to the high cost of feed for poultry, there is continuous pressure to formulate ‘least-cost’ diets that meet nutritional requirements. However, the main…”
Get full text

Investigation of growth rate dispersion in lactose crystallisation by AFM by Dincer, T.D., Ogden, M.I., Parkinson, G.M.

“…α-Lactose monohydrate crystals have been reported to exhibit growth rate dispersion (GRD). Variation in surface dislocations has been suggested as the cause of…”
Get full text

Effect of insoluble fiber supplementation applied at different ages on digestive organ weight and digestive enzymes of layer-strain poultry by Yokhana, J.S., Parkinson, G., Frankel, T.L.

Get full text

Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation by Wei, Dengguo, Parkinson, Gary N, Reszka, Anthony P, Neidle, Stephen

“…We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the…”
Get full text

Defining the Paragoethite process for iron removal in zinc hydrometallurgy by Loan, M., Newman, O.M.G., Cooper, R.M.G., Farrow, J.B., Parkinson, G.M.

“…The previously ambiguous Paragoethite process and residue are defined, and the importance of a fundamental understanding of iron-phase precipitation in…”
Get full text

The structure of telomeric DNA by Neidle, Stephen, Parkinson, Gary N

“…The telomere is a nucleoprotein complex located at the ends of eukaryotic chromosomes. It is essential for maintaining the integrity of the genome. It is not a…”
Get full text

Crystal structure of parallel quadruplexes from human telomeric DNA by Neidle, Stephen, Parkinson, Gary N, Lee, Michael P. H

“…Telomeric ends of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, are fundamental in protecting the cell from recombination and…”
Get full text

Putative DNA Quadruplex Formation within the Human c-kit Oncogene by Rankin, Sarah, Reszka, Anthony P, Huppert, Julian, Zloh, Mire, Parkinson, Gary N, Todd, Alan K, Ladame, Sylvain, Balasubramanian, Shankar, Neidle, Stephen

“…The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular…”
Get full text

The structure of epitaxial V2O3 films and their surfaces: A medium energy ion scattering study by Window, A.J., Hentz, A., Sheppard, D.C., Parkinson, G.S., Woodruff, D.P., Unterberger, W., Noakes, T.C.Q., Bailey, P., Ganduglia-Pirovano, M.V., Sauer, J.

“…Medium energy ion scattering, using 100keVH+ incident ions, has been used to investigate the growth of epitaxial films, up to thicknesses of ~200Å, of V2O3 on…”
Get full text

V2O3(0001) surface termination: phase equilibrium by Window, A J, Hentz, A, Sheppard, D C, Parkinson, G S, Niehus, H, Ahlbehrendt, D, Noakes, T C Q, Bailey, P, Woodruff, D P

“…Complementary but independent medium-energy and low-energy ion scattering studies of the (0001) surfaces of V(2)O(3) films grown on Pd(111), Au(111) and…”
Get full text

A New Class of Symmetric Bisbenzimidazole-Based DNA Minor Groove-Binding Agents Showing Antitumor Activity by Mann, John, Baron, Anne, Opoku-Boahen, Yaw, Johansson, Eric, Parkinson, Gary, Kelland, Lloyd R, Neidle, Stephen

“…The synthesis and evaluation of the novel head-to-head bisbenzimidazole compound 2,2-bis[4‘-(3‘ ‘-dimethylamino-1‘ ‘-propyloxy)phenyl]-5,5-bi-1H-benzimidazole…”
Get full text

The effect of nano-scale topography on keratinocyte phenotype and wound healing following burn injury by Parkinson, Leigh G, Rea, Suzanne M, Stevenson, Andrew W, Wood, Fiona M, Fear, Mark W

“…Topographic modulation of tissue response is an important consideration in the design and manufacture of a biomaterial. In developing new tissue therapies for…”
Get more information

War and the Imperative of Union by Parkinson, Robert G

“…Staughton Lynd and David Waldstreicher attempt to cut across old divisions in the historiography of the American Revolution between whigs and progressives (or…”
Get full text

Crystal Structure of the Potassium Form of an Oxytricha nova G-quadruplex by Haider, Shozeb, Parkinson, Gary N., Neidle, Stephen

“…The crystal structures of the potassium-containing quadruplex formed from the Oxytricha nova sequence d(GGGGTTTTGGGG) are reported, in two space groups, the…”
Get full text