Search Results - "Paoletti, Jacques"

A topological mechanism for TRF2-enhanced strand invasion by Angelov, Dimitar, Bouvet, Philippe, Faivre-Moskalenko, Cendrine, Amiard, Simon, Hug, Nele, Lenain, Christelle, Giraud-Panis, Marie-Josèphe, Gilson, Eric, Poulet, Anaïs, Paoletti, Jacques, Vindigni, Alessandro, Doudeau, Michel, Pinte, Sébastien

“…Telomeres can fold into t-loops that may result from the invasion of the 3' overhang into duplex DNA. Their formation is facilitated in vitro by the telomeric…”
Get full text

NCp7 Activates HIV-1Lai RNA Dimerization by Converting a Transient Loop-Loop Complex into a Stable Dimer by Muriaux, Delphine, De Rocquigny, Hugues, Roques, Bernard-Pierre, Paoletti, Jacques

“…Nucleocapsid protein 7 (NCp7), the human immunodeficiency virus type 1 (HIV-1) nucleocapsid protein, was shown to strongly potentiate the dimerization of the…”
Get full text

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex by Barbault, Florent, Huynh-Dinh, Tam, Paoletti, Jacques, Lancelot, Gérard

“…The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of…”
Get full text

HIV-1 Lai genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Huynh-Dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, G rard, Barbault, Florent, Paquet, Fran oise

Get full text

An Unusually Stable Purine(Purine-Pyrimidine) Short Triplex by Svinarchuk, Fedor, Paoletti, Jacques, Malvy, Claude

“…Classical models for DNA triple helix formation assume the stabilization of these structures through the formation of Hoogsteen hydrogen bonds. This assumes…”
Get full text

Dimerization of HIV-1Lai RNA at Low Ionic Strength by Muriaux, Delphine, Girard, Pierre-Marie, Bonnet-Mathonière, Bénédicte, Paoletti, Jacques

“…Genomic human immunodeficiency virus type 1 (HIV-1) RNA consists of two identical RNA molecules joined noncovalently near their 5′ ends in a region called the…”
Get full text

A new NMR solution structure of the SL1 HIV-1Lai loop–loop dimer by Kieken, Fabien, Paquet, Françoise, Brulé, Fabienne, Paoletti, Jacques, Lancelot, Gérard

“…Dimerization of genomic RNA is directly related with the event of encapsidation and maturation of the virion. The initiating sequence of the dimerization is a…”
Get full text

A Kissing Complex Together with a Stable Dimer Is Involved in the HIV-1Lai RNA Dimerization Process in Vitro by Muriaux, Delphine, Fossé, Philippe, Paoletti, Jacques

“…Retroviruses contain a dimeric RNA consisting of two identical molecules of genomic RNA. The interaction between the two monomers is thought to occur near…”
Get full text

Dimerization of HIV-1Lai RNA at low ionic strength. An autocomplementary sequence in the 5' leader region is evidenced by an antisense oligonucleotide by Muriaux, D, Girard, P M, Bonnet-Mathonière, B, Paoletti, J

“…Genomic human immunodeficiency virus type 1 (HIV-1) RNA consists of two identical RNA molecules joined noncovalently near their 5' ends in a region called the…”
Get full text

A topological mechanism for TRF2-enhanced strand invasion by Amiard, Simon, Doudeau, Michel, Pinte, Sébastien, Poulet, Anaïs, Lenain, Christelle, Faivre-Moskalenko, Cendrine, Angelov, Dimitar, Hug, Nele, Vindigni, Alessandro, Bouvet, Philippe, Paoletti, Jacques, Gilson, Eric, Giraud-Panis, Marie-Josèphe

Get full text

Characterization of loose and tight dimer forms of avian leukosis virus RNA by Polge, Emmanuelle, Darlix, Jean-Luc, Paoletti, Jacques, Fossé, Philippe

“…Retroviral genomes consist of two identical RNA molecules joined non-covalently near their 5′-ends. Recently, we showed that an imperfect autocomplementary…”
Get full text

A Short Autocomplementary Sequence Plays an Essential Role in Avian Sarcoma−Leukosis Virus RNA Dimerization by Fossé, Philippe, Motté, Nelly, Roumier, Anne, Gabus, Caroline, Muriaux, Delphine, Darlix, Jean-Luc, Paoletti, Jacques

“…Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5‘-ends. Recently, two models have been proposed for RNA dimer…”
Get full text

A Short Autocomplementary Sequence in the 5' Leader Region Is Responsible for Dimerization of MoMuLV Genomic RNA by Girard, Pierre-Marie, Bonnet-Mathoniere, Benedicte, Muriaux, Delphine, Paoletti, Jacques

“…Previous work has shown that a region of Moloney murine leukemia virus (MoMuLV) RNA located between nucleotides 280 and 330 in the PSI region (nt 215-565) is…”
Get full text

HIV-1Lai genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Françoise, Huynh-dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gérard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

HIV-1(Lai) genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Françoise, Huynh-Dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gérard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

A Kissing Complex Together with a Stable Dimer Is Involved in the HIV-1 Lai RNA Dimerization Process in Vitro by Muriaux, Delphine, Fossé, Philippe, Paoletti, Jacques

Get full text

HIV-1 sub(Lai) genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Francoise, Huynh-Dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gerard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

Effect of dimerization on the conformation of the encapsidation Psi domain of Moloney murine leukemia virus RNA by Tounekti, N, Mougel, M, Roy, C, Marquet, R, Darlix, J L, Paoletti, J, Ehresmann, B, Ehresmann, C

“…In Moloney murine leukemia virus, the encapsidation Psi element was shown to be necessary and sufficient to promote packaging of viral RNA, and to be required…”
Get more information

Conformational analysis of the 5' leader and the gag initiation site of Mo-MuLV RNA and allosteric transitions induced by dimerization by Mougel, Marylene, Tounekti, Naceur, Darlix, Jean-Luc, Paoletti, Jacques, Ehresmann, Bernard, Ehresmann, Chantal

“…Dimerization of genomic RNA is a key step in the retroviral life cycle and has been postulated to be involved in the regulation of translation, encapsidation…”
Get full text

Modeling the dynamics of a mutated stem-loop in the SL1 domain of HIV-1Lai genomic RNA by 1H-NOESY spectra by Fausti, S, La Penna, G, Paoletti, J, Genest, D, Lancelot, G, Perico, A

“…The cross-peaks of 1H-NOESY spectra at different time delays are compared to a mode-coupling diffusion (MCD) calculation, including the evaluation of the full…”
Get full text