Search Results - "Lancelot, Gerard"

Refined solution structure and backbone dynamics of the archaeal MC1 protein by Paquet, Françoise, Loth, Karine, Meudal, Hervé, Culard, Françoise, Genest, Daniel, Lancelot, Gérard

“…The 3D structure of methanogen chromosomal protein 1 (MC1), determined with heteronuclear NMR methods, agrees with its function in terms of the shape and…”
Get full text

A new NMR solution structure of the SL1 HIV-1Lai loop–loop dimer by Kieken, Fabien, Paquet, Françoise, Brulé, Fabienne, Paoletti, Jacques, Lancelot, Gérard

“…Dimerization of genomic RNA is directly related with the event of encapsidation and maturation of the virion. The initiating sequence of the dimerization is a…”
Get full text

NMR solution structure of a DNA dodecamer containing a transplatin interstrand GN7-CN3 cross-link by Paquet, Françoise, Boudvillain, Marc, Lancelot, Gérard, Leng, Marc

“…The DNA duplex d(CTCTCG*AGTCTC) d(GAGAC-TC*GAGAG) containing a single trans-diammine-dichloroplatinum(ll) interstrand cross-link (where G* and C* represent the…”
Get full text

Conformational study of the dipeptide arginylglutamic acid and of its complex with nucleic bases by Lancelot, Gerard, Mayer, Roger, Helene, Claude

Get full text

Conformational study of the tetrapeptide Boc-Arg-Ala-Gly-Glu-NHEt. A .beta. turn locked by a salt bridge by Mayer, Roger, Lancelot, Gerard

“…The conformation of the tetrapeptide Boc-Arg-Ala-Gly-Glu-NHEt is obtained from super(1)H NMR spectra analysis in Me sub(2)SO-d sub(6). An intramolecular…”
Get full text

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex by Barbault, Florent, Huynh-Dinh, Tam, Paoletti, Jacques, Lancelot, Gérard

“…The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of…”
Get full text

HIV-1 sub(Lai) genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Francoise, Huynh-Dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gerard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

Study of structure, base-pair opening kinetics and proton exchange mechanism of the d-(AATTGCAATT) self-complementary oligodeoxynucleotide in solution by KOCHOYAN, M, LANCELOT, G, LEROY, J. L

“…Using proton magnetic resonance, we have investigated the structure and the base-pair opening kinetics of the d-(AATTGCAATT) self-complementary duplex. All the…”
Get full text

Selectively carbon-13-enriched DNA: carbon-13 and proton assignments of the lac operator by two-dimensional relayed HMQC experiments. [Erratum to document cited in CA118(11):97349m] by Lancelot, Gerard, Chanteloup, Luc, Beau, Jean Marie, Nguyen Thanh Thuong

Get full text

Selectively carbon-13-enriched DNA: carbon-13 and proton assignments of the lac operator by two-dimensional relayed HMQC experiments by Lancelot, Gerard, Chanteloup, Luc, Beau, Jean Marie, Nguyen Thanh Thuong

Get full text

NMR Solution Structure of the Archaebacterial Chromosomal Protein MC1 Reveals a New Protein Fold by Paquet, Françoise, Culard, Françoise, Barbault, Florent, Maurizot, Jean-Claude, Lancelot, Gérard

“…The three-dimensional structure of methanogen chromosomal protein 1 (MC1), a chromosomal protein extracted from the archaebacterium Methanosarcina sp. CHTI55,…”
Get full text

Changes inlac Operator dynamics upon selective interaction withlac Repressor as revealed by heteronuclear relaxation rate measurements by Paquet, Françoise, Maurizot, Jean-Claude, Lancelot, Gérard

“…Structural and dynamic studies of the lac Operator complexed with the headpiece of the lac Repressor are necessary to establish whether the two partners have…”
Get full text

Selective Recognition of Nucleic Acids by Proteins: The Specificity of Guanine Interaction with Carboxylate Ions by Lancelot, Gerard, Helene, Claude

“…The interaction of carboxylate ions (acetate, butyrate) with nucleic acid bases and nucleosides has been investigated by proton magnetic resonance in dimethyl…”
Get full text

HIV-1Lai genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Françoise, Huynh-dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gérard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

NMR Studies of lac Operator and lac Repressor by LANCELOT, GÉRARD, PAQUET, FRANÇOISE

“…For many years, and even now, the lac operon of Escherichia coli has been a model for gene regulation. The lac repressor is a tetrameric protein that binds…”
Get full text

HIV-1(Lai) genomic RNA: combined used of NMR and molecular dynamics simulation for studying the structure and internal dynamics of a mutated SL1 hairpin by Kieken, Fabien, Arnoult, Eric, Barbault, Florent, Paquet, Françoise, Huynh-Dinh, Tam, Paoletti, Jacques, Genest, Daniel, Lancelot, Gérard

“…The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor…”
Get full text

A multigram, stereoselective synthesis of d-[ 13C 5]ribose from d-[ 13C 6]glucose and its conversion into [ 13C 5]nucleosides by Agrofoglio, Luigi A., Jacquinet, Jean-Claude, Lancelot, Gérard

“…The preparation of 13C-labeled ribonucleosides starting from d-[ 13C 6]glucose in 45% overall yield is described. The key of this short synthetic way is the…”
Get full text

Modeling the dynamics of a mutated stem-loop in the SL1 domain of HIV-1Lai genomic RNA by 1H-NOESY spectra by Fausti, S, La Penna, G, Paoletti, J, Genest, D, Lancelot, G, Perico, A

“…The cross-peaks of 1H-NOESY spectra at different time delays are compared to a mode-coupling diffusion (MCD) calculation, including the evaluation of the full…”
Get full text

The HIV-1(Lai) RNA dimerization. Thermodynamic parameters associated with the transition from the kissing complex to the extended dimer by Theilleux-Delalande, V, Girard, F, Huynh-Dinh, T, Lancelot, G, Paoletti, J

“…Retroviruses contain dimeric RNA consisting of two identical copies of the genomic RNA. The interaction between these two RNA molecules occurs near their 5'…”
Get full text

Solution structure of a selectively 13C-labeled intramolecular DNA triplex by Bornet, O, Lancelot, G

“…The three-dimensional structure of an intramolecular triple helix whose three strands have been linked by a hexaethylene glycol chain, and selectively…”
Get more information