Search Results - "Gysi, Stephan"

A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans by Gysi, Stephan, Rhiner, Christa, Flibotte, Stephane, Moerman, Donald G, Hengartner, Michael O

“…Heparan sulfate proteoglycans (HSPGs) are proteins with long covalently attached sugar side chains of the heparan sulfate (HS) type. Depending on the cellular…”
Get full text

Syndecan regulates cell migration and axon guidance in C. elegans by Rhiner, Christa, Gysi, Stephan, Fröhli, Erika, Hengartner, Michael O, Hajnal, Alex

“…During nervous system development, axons that grow out simultaneously in the same extracellular environment are often sorted to different target destinations…”
Get full text

ccz-1 mediates the digestion of apoptotic corpses in C. elegans by Nieto, Cristina, Almendinger, Johann, Gysi, Stephan, Gómez-Orte, Eva, Kaech, Andres, Hengartner, Michael O, Schnabel, Ralf, Moreno, Sergio, Cabello, Juan

“…During development, the processes of cell division, differentiation and apoptosis must be precisely coordinated in order to maintain tissue homeostasis. The…”
Get full text

Correction: A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans by Gysi, Stephan, Rhiner, Christa, Flibotte, Stephane, Moerman, Donald G., Hengartner, Michael O.

“…In Table 1, regarding the allele op468, the correct breakpoints are as follows: 5': AAATCAATATTTCAGCAATCG 3': AAGAGTTCATTTAGCTGTAT Citation: Gysi S, Rhiner C,…”
Get full text

Correction: A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in by Stephan Gysi, Christa Rhiner, Stephane Flibotte, Donald G. Moerman, Michael O. Hengartner

Get full text