Search Results - "Chernov, B.K."

Conservation of the secondary structure elements of the 5'-untranslated region of cardio- and aphthovirus RNAs by PILIPENKO, E. V, BLINOV, V. M, CHERNOV, B. K, DMITRIEVA, T. M, AGOL, V. I

“…An analysis of published nucleotide sequences of the 5'-untranslated region (5'-UTR) of 7 cardioviruses and 3 aphthoviruses has allowed us to derive a…”
Get full text

Conserved and variable elements in RNA genomes of potexviruses by Skryabin, K.G., Morozov, S.Yu, Kraev, A.S., Rozanov, M.N., Chernov, B.K., Lukasheva, L.I., Atabekov, J.G.

“…The nucleotide sequences of genomic RNAs and predicted amino acid sequences of two strains of potato virus X and white clover mosaic potexvirus were compared…”
Get full text

Poly(A) Addition Site Mapping and Polyadenylation Signal Analysis in a Plant Circovirus Replication-Related Gene by Merits, A., Zelenina, D.A., Mizenina, O.A., Chernov, B.K., Morozov, S.Yu

“…The transcripts of a genomic component of coconut foliar decay virus (CFDV), a plant circovirus with a single-stranded DNA genome, were characterized by…”
Get full text

RNA-binding properties of the 63 kDa protein encoded by the triple gene block of poa semilatent hordeivirus by Kalinina, N.O, Rakitina, D.A, Yelina, N.E, Zamyatnin, A.A. Jr, Stroganova, T.A, Klinov, D.V, Prokhorov, V.V, Ustinova, S.V, Chernov, B.K, Schiemann, J

“…The 63 kDa '63K' movement protein encoded by the triple gene block of poa semilatent virus (PSLV) comprises the C-terminal NTPase/helicase domain and the…”
Get full text

DNA sequence recognition by bis-linked netropsin and distamycin derivatives by Grokhovsky, S.L, Surovaya, A.N, Burckhardt, G, Pismensky, V.F, Chernov, B.K, Zimmer, Ch, Gursky, G.V

“…We studied the interaction of cis-diammine Pt(II)-bridged bis-netropsin, cis-diammine Pt(II)-bridged bis-distamycin and oligomethylene-bridged bis-netropsin…”
Get full text

Forum domain in Drosophila melanogaster cut locus possesses looped domains inside by Tchurikov, N.A, Krasnov, A.N, Ponomarenko, N.A, Golova, Y.B, Chernov, B.K

“…We have studied the relationship between chromosomal forum domains and looped domains in the cut locus of Drosophila melanogaster. Forum domains were earlier…”
Get full text

De novo design, synthesis and study of albebetin, a polypeptide with a predetermined three-dimensional structure. Probing the structure at the nanogram level by Fedorov, A N, Dolgikh, D A, Chemeris, V V, Chernov, B K, Finkelstein, A V, Schulga, A A, Alakhov YuB, Kirpichnikov, M P, Ptitsyn, O B

“…The de novo polypeptide named albebetin was designed to form the tertiary fold that has not yet been observed in natural proteins. The design was based on the…”
Get more information

Mutants of T7 RNA polymerase that are able to synthesize both RNA and DNA by Kostyuk, D.A., Dragan, S.M., Lyakhov, D.L., Rechinsky, V.O., Tunitskaya, V.L., Chernov, B.K., Kochetkov, S.N.

“…A mutant T7 RNA polymerase (T7 RNAP) having two amino-acid substitutions (Y639F and S641A) is altered in its specificity towards nucleotide substrates, but is…”
Get full text

A complex RNA sequence detemines the internal initiation of encephalomyocarditis virus RNA translation by EVSTAFIEVA, A. G, UGAROVA, T. Y, CHERNOV, B. K, SHATSKY, I. N

Get full text

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence by Borisova, O.F., Shchyolkina, A.K., Chernov, B.K., Tchurikov, N.A.

“…The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5′-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3′…”
Get full text

Nucleotide sequence of the open reading frames adjacent to the coat protein cistron in potato virus X genome by Morozov, S.Yu, Lukasheva, L.I., Chernov, B.K., Skryabin, K.G., Atabekov, J.G.

“…The cloned cDNA copies corresponding to 1300 nucleotides adjacent to the 3'-terminal poly(A) tract of the potato virus X (PVX) genome have been sequenced. The…”
Get full text

A Complex RNA sequence determines the initiation of encephalomyocarditis virus RNA translation by Evstafieva, A.G., Ugarova, T.Y., Chernov, B.K., Shatsky, I.N.

Get full text

In vitro membrane binding of the translation products of the carlavirus 7-kDa protein genes by Morozov, S Y, Miroshnichenko, N A, Solovyev, A G, Zelenina, D A, Fedorkin, O N, Lukasheva, L I, Grachev, S A, Chernov, B K

“…Two double-stranded DNA copies of the genes potentially coding for the 7-kDa proteins of potato virus M (PVM) and potato virus S (PVS) were synthesized and…”
Get more information

Computer-assisted predictions of the secondary structure in the plant virus single-stranded DNA genome by Morozov SYu, Chernov, B K, Merits, A, Blinov, V M

“…Coconut foliar decay virus (CFDV) contains the single-stranded circular DNA molecules of 1291 nucleotides which were found to replicate autonomously in the…”
Get more information

Parallel stranded DNA with AT base pairing by Shchyolkina, A.K., Lysov, Yu.P., Il'ichova, I.A., Chernyi, A.A., Golova, Yu.B., Chernov, B.K., Gottikh, B.P., Florentiev, V.L.

“…The concentration and temperature dependences of the UV and CD spectra of the oligonucleotide 3′-d(ApTpApTpApTpApTpApTp)-O(CH 2) 6O-5′-d(pApTpApTpApTpApTpApT)…”
Get full text

Electrophoretic behavior of d(GGAAAAAAGG)n, d(CCAAAAAACC)n, and (CCAAAAAAGG)n and implications for a DNA bending model by ABAGYAN, R. A, MIRONOV, V. N, CHERNOV, B. K, CHUPRINA, V. P, ULYANOV, A. V

“…Double stranded multimers (C2A6C2)n, (C2A6G2)n and (G2A6G2)n were prepared from chemically synthesized oligonucleotides to study the influence of sequences…”
Get full text

1H NMR sudy of the interaction of bacteriophageλ Cro protein with the OR3 operator. Evidence for a change of the conformation of the OR3 operator on binding by Kirpichnikov, M.P., Hahn, K.D., Buck, F., Rüterjans, H., Chernov, B.K., Kurochkin, A.V., Skryabin, K.G., Bayev, A.A.

“…The specific complex between the λ phage OR3 operator and the Cro protein has been studied by proton NMR spectroscopy atR500 MHz. The DNA imino proton…”
Get full text

1 H NMR sudy of the interaction of bacteriophageλ Cro protein with the O R 3 operator. Evidence for a change of the conformation of the O R 3 operator on binding by Kirpichnikov, M.P., Hahn, K.D., Buck, F., Rüterjans, H., Chernov, B.K., Kurochkin, A.V., Skryabin, K.G., Bayev, A.A.

Get full text

Human c-myc gene contains a regulatory site similar to consensus of interferon response sequence (IRS) by Alexandrova, N.M., Itkes, A.V., Imamova, L.R., Chernov, B.K., Tulchinsky, E.M., Ulyanov, N.B., Kisselev, L.L.

“…Expression of c-myc proto oncogene is regulated by multiple mechanisms. Here, we report that the consensus of the regulatory region of interferondependent…”
Get full text

1H NMR study of the interaction of bacteriophage ? Cro protein with the O R 3 operator: II. Assignment of the non-exchangeable proton resonances of the O R 3 operator by Hahn, K.D., Buck, F., R terjans, H., Chernov, B.K., Skryabin, K.G., Kirpichnikov, M.P.

Get full text