Search Results - "Cancilla, Michael R"

A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA by Sart, Desirée du, Saffery, Richard, Barry, Alyssa E, Kalitsis, Paul, Cancilla, Michael R, Tainton, Kellie M, Martyn, John, Choo, K. H. Andy, Mao, Jen-i, Earle, Elizabeth

“…We recently described a human marker chromosome containing a functional neo-centromere that binds anti-centromere antibodies, but is devoid of centromeric…”
Get full text

High-throughput gene mapping in Caenorhabditis elegans by Swan, Kathryn A, Curtis, Damian E, McKusick, Kathleen B, Voinov, Alexander V, Mapa, Felipa A, Cancilla, Michael R

“…Positional cloning of mutations in model genetic systems is a powerful method for the identification of targets of medical and agricultural importance. To…”
Get full text

Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele by Morahan, Grant, Huang, Dexing, Ymer, Susie I, Cancilla, Michael R, Stephen, Katrina, Dabadghao, Preeti, Werther, George, Tait, Brian D, Harrison, Leonard C, Colman, Peter G

“…Type 1 diabetes (T1D; or insulin-dependent diabetes mellitus, IDDM) is an autoimmune disease with both genetic and environmental components. In addition to the…”
Get full text

Chemical genetics identifies Rab geranylgeranyl transferase as an apoptotic target of farnesyl transferase inhibitors by Lackner, Mark R., Kindt, Rachel M., Carroll, Pamela M., Brown, Katherine, Cancilla, Michael R., Chen, Changyou, de Silva, Heshani, Franke, Yvonne, Guan, Bo, Heuer, Tim, Hung, Tak, Keegan, Kevin, Lee, Jae Moon, Manne, Veeraswamy, O’Brien, Carol, Parry, Dianne, Perez-Villar, Juan J., Reddy, Rajashekar K., Xiao, Hong, Zhan, Hangjun, Cockett, Mark, Plowman, Greg, Fitzgerald, Kevin, Costa, Michael, Ross-Macdonald, Petra

“…A chemical genetics approach identified a cellular target of several proapoptotic farnesyl transferase inhibitors (FTIs). Treatment with these FTIs caused…”
Get full text

Centromere Protein B Null Mice Are Mitotically and Meiotically Normal but Have Lower Body and Testis Weights by Hudson, Damien F., Fowler, Kerry J., Earle, Elizabeth, Saffery, Richard, Kalitsis, Paul, Trowell, Helen, Hill, Joanne, Wreford, Nigel G., de Kretser, David M., Cancilla, Michael R., Howman, Emily, Hii, Linda, Cutts, Suzanne M., Irvine, Danielle V., Choo, K. H. A.

“…CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier…”
Get full text

Sequence Analysis of an 80 kb Human Neocentromere by Barry, Alyssa E., Howman, Emily V., Cancilla, Michael R., Saffery, Richard, Andy Choo, K. H.

“…We previously described the cloning of an 80 kb DNA corresponding to the core protein-binding domain of a human chromosome 10-derived neocentromere. Here we…”
Get full text

Construction of Neocentromere-Based Human Minichromosomes by Telomere-Associated Chromosomal Truncation by Saffery, Richard, Wong, Lee H., Irvine, Danielle V., Bateman, Melissa A., Griffiths, Belinda, Cutts, Suzanne M., Cancilla, Michael R., Cendron, Angela C., Stafford, Angela J., K. H. Andy Choo

“…Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking α-satellite DNA. Using telomere-associated…”
Get full text

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase by EARLE, E, SAXENA, A, MACDONAID, A, HUDSON, D. F, SHAFFER, L. G, SAFFERY, R, CANCILLA, M. R, CUTTS, S. M, HOWMAN, E, CHOO, K. H. A

“…A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated…”
Get full text

The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: further evidence for epigenetic modification by Barry, A E, Bateman, M, Howman, E V, Cancilla, M R, Tainton, K M, Irvine, D V, Saffery, R, Choo, K H

“…We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has…”
Get full text

Specific isolation of human rDNA genes by TAR cloning by Kouprina, Natalya, Graves, Joan, Cancilla, Michael R, Resnick, Michael A, Larionov, Vladimir

“…Selective cloning of human DNA in YACs from monochromosomal human/rodent hybrid cells lines and radiation hybrids can be accomplished by…”
Get full text

Direct Cloning of Human 10q25 Neocentromere DNA Using Transformation-Associated Recombination (TAR) in Yeast by Cancilla, Michael R., Tainton, Kellie M., Barry, Alyssa E., Larionov, Vladimir, Kouprina, Natalya, Resnick, Michael A., Sart, Desiree Du, Choo, K.H.Andy

“…The transformation-associated recombination (TAR) procedure allows rapid, site-directed cloning of specific human chromosomal regions as yeast artificial…”
Get full text

Cloning and characterization of the genes encoding the ankyrin repeat and SOCS box-containing proteins Asb-1, Asb-2, Asb-3 and Asb-4 by Kile, Benjamin T., Viney, Elizabeth M., Willson, Tracy A., Brodnicki, Thomas C., Cancilla, Michael R., Herlihy, Amy S., Croker, Ben A., Baca, Manuel, Nicola, Nicos A., Hilton, Douglas J., Alexander, Warren S.

“…Members of the suppressor of cytokine signalling (SOCS) family of proteins have been shown to inhibit cytokine signalling via direct interactions with JAK…”
Get full text

Rapid Genomic Fingerprinting of Lactococcus lactis Strains by Arbitrarily Primed Polymerase Chain Reaction with (32)P and Fluorescent Labels by Cancilla, Michael R, Powell, Ian B

“…Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for…”
Get full text

Lactococcus lactis glyceraldehyde-3-phosphate dehydrogenase gene, gap: further evidence for strongly biased codon usage in glycolytic pathway genes by Cancilla, Michael R, Hillier, Alan J, Davidson, Barrie E

“…Russell Grimwade School of Biochemistry, University of Melbourne, Parkville, Victoria 3052, Australia Commonwealth Scientific and Industrial Research…”
Get full text

The Lactococcus lactis triosephosphate isomerase gene, tpi, is monocistronic by Cancilla, Michael R, Davidson, Barrie E, Hillier, Alan J, Nguyen, Nga Y, Thompson, John

“…1 Russell Grimwade School of Biochemistry, University of Melbourne, Parkville, Victoria 3052, Australia 2 Commonwealth Scientific and Industrial Research…”
Get full text